जीव विज्ञान प्रश्न बैंक – 21 “मानव में विरासत” पर उत्तर के साथ लघु प्रश्न | Biology Question Bank – 21 Short Questions With Answers On “Inheritance In Human”

Biology Question Bank – 21 Short Questions With Answers on “Inheritance in Human” | जीव विज्ञान प्रश्न बैंक - 21 "मानव में विरासत" पर उत्तर के साथ लघु प्रश्न

जीव विज्ञान के छात्रों के लिए “मानव में विरासत” पर उत्तर और स्पष्टीकरण के साथ 21 प्रश्न:

Q. 1. डीएनए की लंबाई का आधार क्या है?

उत्तर। यह इसमें मौजूद न्यूक्लियोटाइड जोड़े की संख्या पर निर्भर करता है।

प्रश्न 2. उन अणुओं के नाम बताइए जो पोलीन्यूक्लियोटाइड श्रृंखला की रीढ़ की हड्डी बनाते हैं।

उत्तर। (1) चीनी

(2) फॉस्फेट।

Q. 3. एडेनिन और थाइमिन और गुआनाइन और साइटोसिन के बीच अनुपात क्या हैं?

उत्तर। यह स्थिर है और एक के बराबर है।

Q. 4. डीऑक्सीराइबोज न्यूक्लिक एसिड की अम्लीय प्रकृति की पहचान किसने की?

उत्तर। फ्रेंडरिच मीशर।

Q. 5. आणविक जीव विज्ञान के केंद्रीय सिद्धांत का प्रस्ताव किसने दिया?

वर्षों। फ्रांसिस क्रिक।

Q. 6. आणविक जीव विज्ञान में केंद्रीय सिद्धांत क्या है?

उत्तर। डीएनए से सूचना का प्रवाह -» आरएनए -> प्रोटीन को आणविक जीव विज्ञान में केंद्रीय हठधर्मिता कहा जाता है।

प्रतिकृति—– प्रतिलेखन अनुवाद

डीएनए ———————» RNA में——————— » प्रोटीन

प्रश्न 7. ‘बीड्स-ऑन-ए स्ट्रिंग’ शब्द का क्या अर्थ है?

उत्तर। यह एक क्रोमैटिन में न्यूक्लियोसोम के लिए खड़ा है।

Q. 8. ग्रिफिथ के चूहों के प्रयोग का निष्कर्ष क्या था?

उत्तर। जब गर्मी ने एस-टाइप बैक्टीरिया को आर-टाइप बैक्टीरिया के साथ मिलाया, तो चूहों को इंजेक्शन लगाया गया, इसने आर टाइप को एस टाइप बैक्टीरिया में बदल दिया और निमोनिया के कारण चूहों को मार दिया।

Q. 9. O. Avery, C. Macleod और M. Mccarty का क्या काम था?

उत्तर। उन्होंने उस सामग्री को अलग कर दिया जिसने आर टाइप बैक्टीरिया को एस टाइप बैक्टीरिया में बदल दिया। यह डीएनए था।

Q. 10. किसके प्रयोगों ने साबित किया कि डीएनए आनुवंशिक पदार्थ है?

उत्तर। ए। हर्षे और मार्क्स बैक्टीरियोफेज का पीछा करते हैं।

प्रश्न 11. एक कोशिका में डीऑक्सीराइबोन्यूक्लियोटाइड्स ट्राइफॉस्फेट की दोहरी भूमिका/कार्यों का उल्लेख करें।

उत्तर। (1) पोलीमराइजेशन के लिए सब्सट्रेट के रूप में कार्य करें

(2) पोलीमराइजेशन के लिए ऊर्जा प्रदान करें

प्रश्न 12. पोलीमराइजेशन की दो विशेषताओं का उल्लेख करें?

उत्तर। (1) उच्च गति – 2000 बीपी/सेकंड। लगभग।

(2) सटीकता की उच्च डिग्री।

प्रश्न 13. डीएनए में उन क्षेत्रों का उल्लेख करें जो प्रतिलेखन इकाई के रूप में कार्य करते हैं?

वर्षों।

(i) एक प्रमोटर,

(ii) संरचनात्मक जीन,

(iii) टर्मिनेटर।

Q. 14. DNA पोलीमरेज़ और RNA पोलीमरेज़ में क्या समानता है?

उत्तर। दोनों डीएनए पर निर्भर एंजाइम हैं और केवल एक दिशा में पोलीमराइजेशन करते हैं, यानी 5’à 3′।

प्र. 15. यदि DNA के एक रज्जुक का क्रम इस प्रकार लिखा जाता है: TACGTACGTACGTACGTACGT ACGTACG पूरक स्टैंड के अनुक्रम को 5′-3′ में लिखिए।

वर्षों। 5′- एटीजीसीएटीजीसीए टीजीसीएटीजी कैटजीसीए टीजीसीएटीजीसी – 3

प्रश्न 16. यदि एक ट्रांसक्रिप्शन इकाई में कोडिंग स्ट्रैंड का अनुक्रम निम्नानुसार लिखा गया है: 5′ एटीजीसी एटीजीसीएटीजीसीए टीजीसी एटीजीसी एटीजीसीएटीजीसी-3′ आरएनए में पूरक स्ट्रैंड के अनुक्रम को लिखें।

वर्षों। UACGUACGUACG UACGUA CGUACGUACG:

प्रश्न 17. ऑपेरॉन क्या है?

उत्तर। बैक्टीरिया के एक पॉलीसिस्ट्रोनिक संरचनात्मक जीन, प्रमोटर और नियामक जीन को ऑपेरॉन कहा जाता है।

प्रश्न 18. शब्दों का विस्तार करें – एचजीपी, बीएसी

उत्तर। मानव जीनोम परियोजना, बीएसी – जीवाणु कृत्रिम गुणसूत्र।

प्रश्न 19. उपग्रह डीएनए क्या है?

उत्तर। डीएनए अनुक्रम में डीएनए फिंगर प्रिंटिंग के दौरान बनने वाली छोटी चोटियों को उपग्रह डीएनए कहा जाता है।

Q. 20. डीएनए फिंगर प्रिंटिंग में VNTR क्या है?

उत्तर। जांच के रूप में उपग्रह डीएनए का उपयोग (जो बहुत उच्च स्तर के बहुरूपता को दर्शाता है) को अग्रानुक्रम दोहराव की परिवर्तनीय संख्या (VNTR) कहा जाता है।

प्रश्न 21. अनुवाद के दौरान राइबोसोम की दो आवश्यक भूमिकाओं की सूची बनाएं। (एनसीईआरटी)

उत्तर। (1) टीआरएनए का चार्ज या टीआरएनएस का अमीनोसिलेशन।

(2) पेप्टाइड बॉन्ड बनाकर अमीनो एसिड के बंधन के लिए उत्प्रेरक का काम करता है।


You might also like